algorithms imagej nih (Oxford Instruments)
Oxford Instruments is a verified supplier 
Oxford Instruments manufactures this product 
99
Structured Review
Oxford Instruments
algorithms imagej nih
Algorithms Imagej Nih, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+nih/Imaris/pm41824461-294-101-105
Average 99 stars, based on 44287 article reviews
Algorithms Imagej Nih, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 44287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+nih/Imaris/pm41824461-294-101-105
Average 99 stars, based on 44287 article reviews
algorithms imagej nih - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
other:Article Title: Mitotic ER-mitochondria contact enhances mitochondrial Ca 2+ influx to promote cell division. Article Snippet: HCT116, HEK-293T and HeLa cells were purchased from ATCC. Article Title: Vertebrate centromeres in mitosis are functionally bipartite structures stabilized by cohesin. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER siRAD21 SMARTpool: ON-TARGET plus -J-006832-06: GCUCAGCCUUUGUGGAAUAJ-006832-07: GGGAGUAGUUCGAAUCUAUJ-006832-08: GACCAAGGUUCCAUAUUAUJ-006832-09: GCAUUGGAGCCUAUUGAUA Dharmacon L-006832-00-0010 siWAPL: GAGAGAUGUUUACGAGUUU Dharmacon J-026287-10 Primers for cloning This paper Table S1 Recombinant DNA pSPgRNA Perez-Pinera et al.74 Addgene plasmid # 47108 pCS446_pSPgSMC3 This study N/A 3xHA-TurboID-NLS_pCDNA3 Branon et al.49 Addgene plasmid #107171 pCRISPaint-mNeon Schmid-Burgk et al.75 Addgene plasmid #174092 pCS452_pCRISPaint-TurboID-pPGK-Hygro This study N/A pCAS9-mCherry-Frame+2 Schmid-Burgk et al.75 Addgene plasmid #66941 pX330 Chien et al.76 Addgene plasmid #158973 pLV-H2B-Neon-ires-Puro Drost et al.77 pLenti6-CENP-A-mCherry Pemble et al.78 Addgene plasmid #89767 Software and Article Title: Methionine secreted by tumor-associated pericytes supports cancer stem cells in clear cell renal carcinoma. Article Snippet: Article Software:Article Title: In toto imaging shows intravascular proliferation promotes transmigration of daughter cells during brain invasion of Cryptococcus neoformans. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and Article Title: MSH6 regulates cGAS activity in antiviral and antitumor signaling pathways by governing its cytosolic/nuclear distribution. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Sting knockout B16-F10 This paper N/A cGas/Msh6 knockout B16-F10 This paper N/A Experimental models: Organisms/strains C57BL/6J mice (wild-type) SPF (Beijing) Biotechnology Co., Ltd RRID: MGI:3028467 Oligonucleotides ISD:sense 5 ′ -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-3 ′ This paper N/A primers for RT-qPCR, see Table S2 This paper N/A sgRNA and shRNA, see Table S3 This paper N/A Recombinant DNA ISRE-Luc Hongbing Shu, Wuhan University N/A IFNβ-Luc Hongbing Shu, Wuhan University N/A NF-κB-Luc Zhijian Chen, University of Texas, Southwestern Medical Center at Dallas N/A Other recombinant DNA used in this study are listed in Table S1 This paper N/A Software and Article Title: The correct connectivity of the DG-CA3 circuits involved in declarative memory processes depends on Vangl2-dependent planar cell polarity signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-bassoon mouse monoclonal antibody Enzo Life Sciences Ref ADI-VAM-PS003 Anti-DCX guinea pig polyclonal antibody Millipore Ref AB2253 Living Colors® DsRed polyclonal antibody Takara/Clontech Ref 632496 Anti-GAPDH mouse monoclonal antibody Millipore Ref MAB374 Anti-GFP chicken polyclonal antibody Abcam Ref Ab13970 Anti-GPC4 rabbit polyclonal antibody Proteintech Ref 13048-1-AP Anti-GPR158 rabbit polyclonal antibody Sigma Ref SAB4502509 Anti-HA.11 mouse monoclonal antibody Biolegend Ref 901513 Anti-myc (clone 9E10) mouse monoclonal antibody Biolegend Ref 626802 Anti-PSD95 mouse monoclonal antibody Thermoscientific Ref MA1-045 Anti-Synaptotagmin7 mouse monoclonal antibody Millipore Ref MABN655 Anti-VGLUT3 mouse monoclonal antibody SySy Ref 135 211 Anti-Synaptoporin rabbit polyclonal antibody SySy Ref 102 002 Anti-synapsin1 rabbit polyclonal antibody SySy Ref 106 002 Anti-Tau (clone PC1C6) mouse monoclonal antibody Millipore Ref MAB3420 Anti-Vangl2 rabbit polyclonal antibody Montcouquiol et al., 2006 Ref 456 Anti-Znt3 mouse monoclonal antibody SySy Ref 197011 Anti-Rabbit Alexa 546 goat secondary antibody Invitrogen Ref A11035 Anti-Rabbit Alexa 488 goat secondary antibody Jackson Laboratory Ref 111-545-144 Anti-Mouse Alexa 594 goat secondary antibody Jackson Laboratory Ref 115-585-166 Anti-Guinea pig Alexa 488 goat secondary antibody Invitrogen Ref A11073 Anti-Chicken Alexa 488 goat secondary antibody Jackson Laboratory Ref 103-545-155 Anti-Rabbit HRP goat secondary antibody Jackson Laboratory Ref 111-035-144 Anti-Mouse HRP goat secondary antibody Jackson Laboratory Ref 115-035-146 Anti-Rabbit HRP mouse secondary antibody Jackson Laboratory Ref 211-032-171 In-situ hybridization probe RNAscope Probe-Mm-Vangl2 Advanced Cell Diagnostics Ref316781 Bacterial and virus strains AAV2/9-CaMKII(0.4)-mCherry- Vector Biolabs Service request [1. .. 9x1012 gcp/ml] AAV2/9-CaMKII(0.4)-mCherry-2A-mVANGL2 -WPRE Vector Biolabs Service request [5.9x1013 gcp/ml or 1.7x1013 gcp/ml] Experimental models: Organisms/strains Vangl2flox mice Prof. D. Henderson, UK Ramsbottom et al., 2014 Plos Genetics Emx1B6.129S2-Emx1tm1(cre)Krj/J (Emx1-Cre) mice Jackson Laboratory RRID:IMSR_JAX:005 628 Jo ur n l P re -p ro of Recombinant DNA GFP-Vangl2 Montcouquiol et al., 2006 HA-GPR158 Condomitti et al., 2018 HA-GPC4 Condomitti et al., 2018 GPC4-myc Origene Ref MR208834 Software and Article Title: Mitotic ER-mitochondria contact enhances mitochondrial Ca 2+ influx to promote cell division. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA Servicebio G5001 STLC Sigma-Aldrich SPE006 MG132 Sigma-Aldrich M8699 Bleomycin sulfate MedChemExpress HY-17565 Protease Inhibitor Cocktail MedChemExpress HY-K0010 Thymidine Sigma-Aldrich V900391 Enhanced chemiluminescence Sigma-Aldrich WBKLS0500 ATP MedChemExpress HY-B0345A DTT Sigma-Aldich D0632 Histamine 3A Chemicals A02646 Triton X-100 Sigma-Aldrich T9284 CGP37157 MedChemExpress HY-15754 EMbed 812 resin Electron Microscopy Sciences #14120 1.4-nm gold-conjugated Fab’ fragment Nanoprobes #2004 Critical commercial assays FastStart Essential DNA Green Master Roche 06402712001 Duolink PLA assay kit Sigma-Aldrich DUO92008 JC-1 assay kit MedChemExpress HY-K0601 Seahorse XF Cell Mito Stress Test Kit Agilent 103015–100 GoldEnhance EM Plus kit Nanoprobes #2114 Deposited data mass spectrometry data of MAM This paper IProX: IPX0006293000 mass spectrometry data of GFP-LBR coIP This paper IProX: IPX0006297000 Experimental models: Cell lines HEK293T cell ATCC CRL-11268 HeLa cell ATCC CCL-2 HCT116 cell ATCC CCL-247 LBR KO HeLa cell This paper N/A EMD KO HeLa cell This paper N/A Oligonucleotides LBR KO sgRNA1: 50- TGACCTTGATCGACTCCCT-30 This paper N/A LBR KO sgRNA2: 50- TTCCCCTTCCAGACGCCGA-30 This paper N/A EMD KO sgRNA: 50- GCGCAGCAAGG TGGTCAGCT-30 This paper N/A Recombinant DNA Plasmid: 4mt-GCaMP6 Gift from Dr. D. De Stefani, University of Padua, Italy N/A Plasmid: mito-R-GECO1.2 Gift from Drs. Jianguo Chen and Junlin Teng, Peking University, China N/A Plasmid: pEGFP-N1-LBR This paper N/A Plasmid: pEGFP-C2-Sec61b This paper N/A Plasmid: pEGFP-N1-LBR211–615 This paper N/A Plasmid: pEGFP-N1-LBR1–585 This paper N/A Plasmid: pEGFP-N1-LBRD211–585 This paper N/A Plasmid: pEGFP-N1-LBR1–210 This paper N/A Plasmid: pEGFP-N1-LBR211–585 This paper N/A (Continued on next page) Cell Reports 43, 114794, October 22, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pEGFP-N1-LBR5A This paper N/A Plasmid: pEGFP-N1-LBR5D This paper N/A Plasmid: pcDNA3.1-flag- AKAP1-BFPUBC6 This paper N/A Plasmid: pcDNA3.1-mCherry-COX8 This paper N/A Plasmid: RFP-H2B Our Laboratory N/A Software and Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and Knock-Out:Article Title: MSH6 regulates cGAS activity in antiviral and antitumor signaling pathways by governing its cytosolic/nuclear distribution. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Sting knockout B16-F10 This paper N/A cGas/Msh6 knockout B16-F10 This paper N/A Experimental models: Organisms/strains C57BL/6J mice (wild-type) SPF (Beijing) Biotechnology Co., Ltd RRID: MGI:3028467 Oligonucleotides ISD:sense 5 ′ -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-3 ′ This paper N/A primers for RT-qPCR, see Table S2 This paper N/A sgRNA and shRNA, see Table S3 This paper N/A Recombinant DNA ISRE-Luc Hongbing Shu, Wuhan University N/A IFNβ-Luc Hongbing Shu, Wuhan University N/A NF-κB-Luc Zhijian Chen, University of Texas, Southwestern Medical Center at Dallas N/A Other recombinant DNA used in this study are listed in Table S1 This paper N/A Software and shRNA:Article Title: MSH6 regulates cGAS activity in antiviral and antitumor signaling pathways by governing its cytosolic/nuclear distribution. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Sting knockout B16-F10 This paper N/A cGas/Msh6 knockout B16-F10 This paper N/A Experimental models: Organisms/strains C57BL/6J mice (wild-type) SPF (Beijing) Biotechnology Co., Ltd RRID: MGI:3028467 Oligonucleotides ISD:sense 5 ′ -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-3 ′ This paper N/A primers for RT-qPCR, see Table S2 This paper N/A sgRNA and shRNA, see Table S3 This paper N/A Recombinant DNA ISRE-Luc Hongbing Shu, Wuhan University N/A IFNβ-Luc Hongbing Shu, Wuhan University N/A NF-κB-Luc Zhijian Chen, University of Texas, Southwestern Medical Center at Dallas N/A Other recombinant DNA used in this study are listed in Table S1 This paper N/A Software and Recombinant:Article Title: MSH6 regulates cGAS activity in antiviral and antitumor signaling pathways by governing its cytosolic/nuclear distribution. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Sting knockout B16-F10 This paper N/A cGas/Msh6 knockout B16-F10 This paper N/A Experimental models: Organisms/strains C57BL/6J mice (wild-type) SPF (Beijing) Biotechnology Co., Ltd RRID: MGI:3028467 Oligonucleotides ISD:sense 5 ′ -TACAGATCTACTAGTGATC TATGACTGATCTGTACATGATCTACA-3 ′ This paper N/A primers for RT-qPCR, see Table S2 This paper N/A sgRNA and shRNA, see Table S3 This paper N/A Recombinant DNA ISRE-Luc Hongbing Shu, Wuhan University N/A IFNβ-Luc Hongbing Shu, Wuhan University N/A NF-κB-Luc Zhijian Chen, University of Texas, Southwestern Medical Center at Dallas N/A Other recombinant DNA used in this study are listed in Table S1 This paper N/A Software and Article Title: The correct connectivity of the DG-CA3 circuits involved in declarative memory processes depends on Vangl2-dependent planar cell polarity signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-bassoon mouse monoclonal antibody Enzo Life Sciences Ref ADI-VAM-PS003 Anti-DCX guinea pig polyclonal antibody Millipore Ref AB2253 Living Colors® DsRed polyclonal antibody Takara/Clontech Ref 632496 Anti-GAPDH mouse monoclonal antibody Millipore Ref MAB374 Anti-GFP chicken polyclonal antibody Abcam Ref Ab13970 Anti-GPC4 rabbit polyclonal antibody Proteintech Ref 13048-1-AP Anti-GPR158 rabbit polyclonal antibody Sigma Ref SAB4502509 Anti-HA.11 mouse monoclonal antibody Biolegend Ref 901513 Anti-myc (clone 9E10) mouse monoclonal antibody Biolegend Ref 626802 Anti-PSD95 mouse monoclonal antibody Thermoscientific Ref MA1-045 Anti-Synaptotagmin7 mouse monoclonal antibody Millipore Ref MABN655 Anti-VGLUT3 mouse monoclonal antibody SySy Ref 135 211 Anti-Synaptoporin rabbit polyclonal antibody SySy Ref 102 002 Anti-synapsin1 rabbit polyclonal antibody SySy Ref 106 002 Anti-Tau (clone PC1C6) mouse monoclonal antibody Millipore Ref MAB3420 Anti-Vangl2 rabbit polyclonal antibody Montcouquiol et al., 2006 Ref 456 Anti-Znt3 mouse monoclonal antibody SySy Ref 197011 Anti-Rabbit Alexa 546 goat secondary antibody Invitrogen Ref A11035 Anti-Rabbit Alexa 488 goat secondary antibody Jackson Laboratory Ref 111-545-144 Anti-Mouse Alexa 594 goat secondary antibody Jackson Laboratory Ref 115-585-166 Anti-Guinea pig Alexa 488 goat secondary antibody Invitrogen Ref A11073 Anti-Chicken Alexa 488 goat secondary antibody Jackson Laboratory Ref 103-545-155 Anti-Rabbit HRP goat secondary antibody Jackson Laboratory Ref 111-035-144 Anti-Mouse HRP goat secondary antibody Jackson Laboratory Ref 115-035-146 Anti-Rabbit HRP mouse secondary antibody Jackson Laboratory Ref 211-032-171 In-situ hybridization probe RNAscope Probe-Mm-Vangl2 Advanced Cell Diagnostics Ref316781 Bacterial and virus strains AAV2/9-CaMKII(0.4)-mCherry- Vector Biolabs Service request [1. .. 9x1012 gcp/ml] AAV2/9-CaMKII(0.4)-mCherry-2A-mVANGL2 -WPRE Vector Biolabs Service request [5.9x1013 gcp/ml or 1.7x1013 gcp/ml] Experimental models: Organisms/strains Vangl2flox mice Prof. D. Henderson, UK Ramsbottom et al., 2014 Plos Genetics Emx1B6.129S2-Emx1tm1(cre)Krj/J (Emx1-Cre) mice Jackson Laboratory RRID:IMSR_JAX:005 628 Jo ur n l P re -p ro of Recombinant DNA GFP-Vangl2 Montcouquiol et al., 2006 HA-GPR158 Condomitti et al., 2018 HA-GPC4 Condomitti et al., 2018 GPC4-myc Origene Ref MR208834 Software and Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and Microscopy:Article Title: The correct connectivity of the DG-CA3 circuits involved in declarative memory processes depends on Vangl2-dependent planar cell polarity signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-bassoon mouse monoclonal antibody Enzo Life Sciences Ref ADI-VAM-PS003 Anti-DCX guinea pig polyclonal antibody Millipore Ref AB2253 Living Colors® DsRed polyclonal antibody Takara/Clontech Ref 632496 Anti-GAPDH mouse monoclonal antibody Millipore Ref MAB374 Anti-GFP chicken polyclonal antibody Abcam Ref Ab13970 Anti-GPC4 rabbit polyclonal antibody Proteintech Ref 13048-1-AP Anti-GPR158 rabbit polyclonal antibody Sigma Ref SAB4502509 Anti-HA.11 mouse monoclonal antibody Biolegend Ref 901513 Anti-myc (clone 9E10) mouse monoclonal antibody Biolegend Ref 626802 Anti-PSD95 mouse monoclonal antibody Thermoscientific Ref MA1-045 Anti-Synaptotagmin7 mouse monoclonal antibody Millipore Ref MABN655 Anti-VGLUT3 mouse monoclonal antibody SySy Ref 135 211 Anti-Synaptoporin rabbit polyclonal antibody SySy Ref 102 002 Anti-synapsin1 rabbit polyclonal antibody SySy Ref 106 002 Anti-Tau (clone PC1C6) mouse monoclonal antibody Millipore Ref MAB3420 Anti-Vangl2 rabbit polyclonal antibody Montcouquiol et al., 2006 Ref 456 Anti-Znt3 mouse monoclonal antibody SySy Ref 197011 Anti-Rabbit Alexa 546 goat secondary antibody Invitrogen Ref A11035 Anti-Rabbit Alexa 488 goat secondary antibody Jackson Laboratory Ref 111-545-144 Anti-Mouse Alexa 594 goat secondary antibody Jackson Laboratory Ref 115-585-166 Anti-Guinea pig Alexa 488 goat secondary antibody Invitrogen Ref A11073 Anti-Chicken Alexa 488 goat secondary antibody Jackson Laboratory Ref 103-545-155 Anti-Rabbit HRP goat secondary antibody Jackson Laboratory Ref 111-035-144 Anti-Mouse HRP goat secondary antibody Jackson Laboratory Ref 115-035-146 Anti-Rabbit HRP mouse secondary antibody Jackson Laboratory Ref 211-032-171 In-situ hybridization probe RNAscope Probe-Mm-Vangl2 Advanced Cell Diagnostics Ref316781 Bacterial and virus strains AAV2/9-CaMKII(0.4)-mCherry- Vector Biolabs Service request [1. .. 9x1012 gcp/ml] AAV2/9-CaMKII(0.4)-mCherry-2A-mVANGL2 -WPRE Vector Biolabs Service request [5.9x1013 gcp/ml or 1.7x1013 gcp/ml] Experimental models: Organisms/strains Vangl2flox mice Prof. D. Henderson, UK Ramsbottom et al., 2014 Plos Genetics Emx1B6.129S2-Emx1tm1(cre)Krj/J (Emx1-Cre) mice Jackson Laboratory RRID:IMSR_JAX:005 628 Jo ur n l P re -p ro of Recombinant DNA GFP-Vangl2 Montcouquiol et al., 2006 HA-GPR158 Condomitti et al., 2018 HA-GPC4 Condomitti et al., 2018 GPC4-myc Origene Ref MR208834 Software and Imaging:Article Title: The correct connectivity of the DG-CA3 circuits involved in declarative memory processes depends on Vangl2-dependent planar cell polarity signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-bassoon mouse monoclonal antibody Enzo Life Sciences Ref ADI-VAM-PS003 Anti-DCX guinea pig polyclonal antibody Millipore Ref AB2253 Living Colors® DsRed polyclonal antibody Takara/Clontech Ref 632496 Anti-GAPDH mouse monoclonal antibody Millipore Ref MAB374 Anti-GFP chicken polyclonal antibody Abcam Ref Ab13970 Anti-GPC4 rabbit polyclonal antibody Proteintech Ref 13048-1-AP Anti-GPR158 rabbit polyclonal antibody Sigma Ref SAB4502509 Anti-HA.11 mouse monoclonal antibody Biolegend Ref 901513 Anti-myc (clone 9E10) mouse monoclonal antibody Biolegend Ref 626802 Anti-PSD95 mouse monoclonal antibody Thermoscientific Ref MA1-045 Anti-Synaptotagmin7 mouse monoclonal antibody Millipore Ref MABN655 Anti-VGLUT3 mouse monoclonal antibody SySy Ref 135 211 Anti-Synaptoporin rabbit polyclonal antibody SySy Ref 102 002 Anti-synapsin1 rabbit polyclonal antibody SySy Ref 106 002 Anti-Tau (clone PC1C6) mouse monoclonal antibody Millipore Ref MAB3420 Anti-Vangl2 rabbit polyclonal antibody Montcouquiol et al., 2006 Ref 456 Anti-Znt3 mouse monoclonal antibody SySy Ref 197011 Anti-Rabbit Alexa 546 goat secondary antibody Invitrogen Ref A11035 Anti-Rabbit Alexa 488 goat secondary antibody Jackson Laboratory Ref 111-545-144 Anti-Mouse Alexa 594 goat secondary antibody Jackson Laboratory Ref 115-585-166 Anti-Guinea pig Alexa 488 goat secondary antibody Invitrogen Ref A11073 Anti-Chicken Alexa 488 goat secondary antibody Jackson Laboratory Ref 103-545-155 Anti-Rabbit HRP goat secondary antibody Jackson Laboratory Ref 111-035-144 Anti-Mouse HRP goat secondary antibody Jackson Laboratory Ref 115-035-146 Anti-Rabbit HRP mouse secondary antibody Jackson Laboratory Ref 211-032-171 In-situ hybridization probe RNAscope Probe-Mm-Vangl2 Advanced Cell Diagnostics Ref316781 Bacterial and virus strains AAV2/9-CaMKII(0.4)-mCherry- Vector Biolabs Service request [1. .. 9x1012 gcp/ml] AAV2/9-CaMKII(0.4)-mCherry-2A-mVANGL2 -WPRE Vector Biolabs Service request [5.9x1013 gcp/ml or 1.7x1013 gcp/ml] Experimental models: Organisms/strains Vangl2flox mice Prof. D. Henderson, UK Ramsbottom et al., 2014 Plos Genetics Emx1B6.129S2-Emx1tm1(cre)Krj/J (Emx1-Cre) mice Jackson Laboratory RRID:IMSR_JAX:005 628 Jo ur n l P re -p ro of Recombinant DNA GFP-Vangl2 Montcouquiol et al., 2006 HA-GPR158 Condomitti et al., 2018 HA-GPC4 Condomitti et al., 2018 GPC4-myc Origene Ref MR208834 Software and Light Microscopy:Article Title: The correct connectivity of the DG-CA3 circuits involved in declarative memory processes depends on Vangl2-dependent planar cell polarity signaling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-bassoon mouse monoclonal antibody Enzo Life Sciences Ref ADI-VAM-PS003 Anti-DCX guinea pig polyclonal antibody Millipore Ref AB2253 Living Colors® DsRed polyclonal antibody Takara/Clontech Ref 632496 Anti-GAPDH mouse monoclonal antibody Millipore Ref MAB374 Anti-GFP chicken polyclonal antibody Abcam Ref Ab13970 Anti-GPC4 rabbit polyclonal antibody Proteintech Ref 13048-1-AP Anti-GPR158 rabbit polyclonal antibody Sigma Ref SAB4502509 Anti-HA.11 mouse monoclonal antibody Biolegend Ref 901513 Anti-myc (clone 9E10) mouse monoclonal antibody Biolegend Ref 626802 Anti-PSD95 mouse monoclonal antibody Thermoscientific Ref MA1-045 Anti-Synaptotagmin7 mouse monoclonal antibody Millipore Ref MABN655 Anti-VGLUT3 mouse monoclonal antibody SySy Ref 135 211 Anti-Synaptoporin rabbit polyclonal antibody SySy Ref 102 002 Anti-synapsin1 rabbit polyclonal antibody SySy Ref 106 002 Anti-Tau (clone PC1C6) mouse monoclonal antibody Millipore Ref MAB3420 Anti-Vangl2 rabbit polyclonal antibody Montcouquiol et al., 2006 Ref 456 Anti-Znt3 mouse monoclonal antibody SySy Ref 197011 Anti-Rabbit Alexa 546 goat secondary antibody Invitrogen Ref A11035 Anti-Rabbit Alexa 488 goat secondary antibody Jackson Laboratory Ref 111-545-144 Anti-Mouse Alexa 594 goat secondary antibody Jackson Laboratory Ref 115-585-166 Anti-Guinea pig Alexa 488 goat secondary antibody Invitrogen Ref A11073 Anti-Chicken Alexa 488 goat secondary antibody Jackson Laboratory Ref 103-545-155 Anti-Rabbit HRP goat secondary antibody Jackson Laboratory Ref 111-035-144 Anti-Mouse HRP goat secondary antibody Jackson Laboratory Ref 115-035-146 Anti-Rabbit HRP mouse secondary antibody Jackson Laboratory Ref 211-032-171 In-situ hybridization probe RNAscope Probe-Mm-Vangl2 Advanced Cell Diagnostics Ref316781 Bacterial and virus strains AAV2/9-CaMKII(0.4)-mCherry- Vector Biolabs Service request [1. .. 9x1012 gcp/ml] AAV2/9-CaMKII(0.4)-mCherry-2A-mVANGL2 -WPRE Vector Biolabs Service request [5.9x1013 gcp/ml or 1.7x1013 gcp/ml] Experimental models: Organisms/strains Vangl2flox mice Prof. D. Henderson, UK Ramsbottom et al., 2014 Plos Genetics Emx1B6.129S2-Emx1tm1(cre)Krj/J (Emx1-Cre) mice Jackson Laboratory RRID:IMSR_JAX:005 628 Jo ur n l P re -p ro of Recombinant DNA GFP-Vangl2 Montcouquiol et al., 2006 HA-GPR158 Condomitti et al., 2018 HA-GPC4 Condomitti et al., 2018 GPC4-myc Origene Ref MR208834 Software and Plasmid Preparation:Article Title: Mitotic ER-mitochondria contact enhances mitochondrial Ca 2+ influx to promote cell division. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA Servicebio G5001 STLC Sigma-Aldrich SPE006 MG132 Sigma-Aldrich M8699 Bleomycin sulfate MedChemExpress HY-17565 Protease Inhibitor Cocktail MedChemExpress HY-K0010 Thymidine Sigma-Aldrich V900391 Enhanced chemiluminescence Sigma-Aldrich WBKLS0500 ATP MedChemExpress HY-B0345A DTT Sigma-Aldich D0632 Histamine 3A Chemicals A02646 Triton X-100 Sigma-Aldrich T9284 CGP37157 MedChemExpress HY-15754 EMbed 812 resin Electron Microscopy Sciences #14120 1.4-nm gold-conjugated Fab’ fragment Nanoprobes #2004 Critical commercial assays FastStart Essential DNA Green Master Roche 06402712001 Duolink PLA assay kit Sigma-Aldrich DUO92008 JC-1 assay kit MedChemExpress HY-K0601 Seahorse XF Cell Mito Stress Test Kit Agilent 103015–100 GoldEnhance EM Plus kit Nanoprobes #2114 Deposited data mass spectrometry data of MAM This paper IProX: IPX0006293000 mass spectrometry data of GFP-LBR coIP This paper IProX: IPX0006297000 Experimental models: Cell lines HEK293T cell ATCC CRL-11268 HeLa cell ATCC CCL-2 HCT116 cell ATCC CCL-247 LBR KO HeLa cell This paper N/A EMD KO HeLa cell This paper N/A Oligonucleotides LBR KO sgRNA1: 50- TGACCTTGATCGACTCCCT-30 This paper N/A LBR KO sgRNA2: 50- TTCCCCTTCCAGACGCCGA-30 This paper N/A EMD KO sgRNA: 50- GCGCAGCAAGG TGGTCAGCT-30 This paper N/A Recombinant DNA Plasmid: 4mt-GCaMP6 Gift from Dr. D. De Stefani, University of Padua, Italy N/A Plasmid: mito-R-GECO1.2 Gift from Drs. Jianguo Chen and Junlin Teng, Peking University, China N/A Plasmid: pEGFP-N1-LBR This paper N/A Plasmid: pEGFP-C2-Sec61b This paper N/A Plasmid: pEGFP-N1-LBR211–615 This paper N/A Plasmid: pEGFP-N1-LBR1–585 This paper N/A Plasmid: pEGFP-N1-LBRD211–585 This paper N/A Plasmid: pEGFP-N1-LBR1–210 This paper N/A Plasmid: pEGFP-N1-LBR211–585 This paper N/A (Continued on next page) Cell Reports 43, 114794, October 22, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pEGFP-N1-LBR5A This paper N/A Plasmid: pEGFP-N1-LBR5D This paper N/A Plasmid: pcDNA3.1-flag- AKAP1-BFPUBC6 This paper N/A Plasmid: pcDNA3.1-mCherry-COX8 This paper N/A Plasmid: RFP-H2B Our Laboratory N/A Software and Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and Data-independent acquisition:Article Title: ADAR1 regulates dsRNA formation in nuclear and mitochondrial transcripts through editing-dependent and -independent mechanisms. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE TM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0008 DTT Sigma Cat# D9779 Dynabeads Protein A Thermo Fisher Scientific Cat# 10008D Dynabeads Protein G Thermo Fisher Scientific Cat# 10009D NP-40 Sigma Cat# I8896 Tris-HCl (1M, pH 8.0) Thermo Fisher Scientific Cat# AM9856 Tris-HCl (1M, pH 7.0) Thermo Fisher Scientific Cat# AM9850 Glycerol Sigma Cat# G5516 Protease inhibitor (cOmplete EDTA-free) Roche Cat# 11873580001 Tween 20 Fisher Cat# BP337-500 Pierce Universal Nuclease Thermo Fisher Scientific Cat# 88701 Glucose Sigma Cat# G7021 Oligomycin-A Sigma Cat# 75351 2DG AlfaAesar Cat# AAL0733806 FCCP Sigma Cat# C2920 Rotenone Sigma Cat# 557368 1M MgCl 2 Thermo Fisher Scientific Cat# AM9530G 0.5M EDTA (pH 8.0) Sigma Cat# 324506 Sodium deoxycholate Sigma Cat# D6750 SDS Sigma Cat# L3771 RNasin® Plus Promega Cat# N2615 GlycoBlue TM Thermo Fisher Scientific Cat# AM9516 ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740 Critical commercial assays NEBNext® Ultra TM II Directional RNA Library Prep Kit for Illumina® NEB Cat# E7765 RiboMinus TM Eukaryote Kit for RNA-seq Thermo Fisher Scientific Cat# A1083708 Direct-zol RNA Miniprep kit Zymo Research Cat# R2052 Deposited data Raw and analyzed sequencing data This paper GSE293278 Proteomics data This paper PXD069896 Experimental models: Cell lines WT-HEK-293T Chung et al. 14 N/A ADAR1 KO-HEK-293T Chung et al. 14 N/A WT-HUES8 Chung et al. 14 N/A ADAR1 KO-HUES8 Chung et al. 14 N/A WT-HeLa Pfaller et al. 16 N/A ADAR1p150KO-HeLa Pfaller et al. 16 N/A ADAR1 KO-HeLa Pfaller et al. 16 N/A WT-HAP1 This paper N/A E912A KI-HAP1 This paper N/A ADAR1 KO-HAP1 This paper N/A Human Dermal Fibroblasts ATCC Cat# PCS-201-012 Oligonucleotides Primers for qRT-PCR, see Table S9 This paper N/A gRNA_ADAR1 KO_clone #1_1: CATGAGATGTGACTGCACAG This paper N/A (Continued on next page) Cell Reports 45, 117026, March 24, 2026 23 .. REAGENT or RESOURCE SOURCE IDENTIFIER gRNA_ADAR1 KO_clone #1_2: GGAATCCATGATGCCCAACA This paper N/A gRNA_ADAR1 KO_clone #2_1: TTCTTGTAGGGTGAACACCG This paper N/A gRNA_ADAR1 KO_clone #2_2: TGATTGGTTTTGGCCGTACG This paper N/A gRNA_E912A KI: GCCATGCAGAAATAATCTCC This paper N/A Donor template_E912A KI_clone #1: AAGGAGATTCTCTCAGCCTAAA AGGAGAAACTGTCAATGACTGCCA TGCAGCCATAATCTCCCGGAGAGGC TTCATCAGGTGAGCGAGGTCAGAGCTG TGGCCCGGCTGCCCGG This paper N/A Donor template_E912A KI_clone #2: TCTCAGCCTAAAAGGAGAAACTGTCAA TGACTGCCATGCAGCCATAATC TCCAGAAGAGGCTTCATCAGG TGAGCGAGGTCAGAGCTGTGG CCCGGCTGCCCGG This paper N/A ON-TARGETplus TM siRNA targeting ADAR1 Dharmacon Cat# L-008630-00-0005 ON-TARGETplus TM siRNA targeting PNPT1 Dharmacon Cat# L-019454-01-0005 ON-TARGETplus TM siRNA targeting SUV3 Dharmacon Cat# L-017841-01-0005 Recombinant DNA pSpCas9(BB)-2A-GFP (PX458) Ran et al. 95 Addgene plasmid Cat# 48138 pcDNA TM 3.1 Thermo Fisher Scientific Cat# V79020 ADAR1p110_pcDNA TM 3.1 This paper N/A ADAR1p150_pcDNA TM 3.1 This paper N/A p150_EAA_pcDNA TM 3.1 This paper N/A p150_E912A_pcDNA TM 3.1 This paper N/A p150_EAA/E912A_pcDNA TM 3.1 This paper N/A hPTGS2_pcDNA3.1 Chen et al. 96 Addgene plasmid Cat# 102498 ISG15_pcDNA TM 3.1 This paper N/A Software and |